|
InterPro Inc
interproscan results ![]() Interproscan Results, supplied by InterPro Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/interproscan results/product/InterPro Inc Average 90 stars, based on 1 article reviews
interproscan results - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
InterPro Inc
interproscan ![]() Interproscan, supplied by InterPro Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/interproscan/product/InterPro Inc Average 90 stars, based on 1 article reviews
interproscan - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
InterPro Inc
secondary metabolites by interproscan (smips) ![]() Secondary Metabolites By Interproscan (Smips), supplied by InterPro Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/secondary metabolites by interproscan (smips)/product/InterPro Inc Average 90 stars, based on 1 article reviews
secondary metabolites by interproscan (smips) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Unigene
blast software ![]() Blast Software, supplied by Unigene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/blast software/product/Unigene Average 90 stars, based on 1 article reviews
blast software - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
InterPro Inc
interpro/interproscan ![]() Interpro/Interproscan, supplied by InterPro Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/interpro/interproscan/product/InterPro Inc Average 90 stars, based on 1 article reviews
interpro/interproscan - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
InterPro Inc
interproscan annotation results InterproScan menu item that appears when the Data Integration link is selected to explore relevant protein signatures of the InterPro member databases. " width="250" height="auto" />Interproscan Annotation Results, supplied by InterPro Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/interproscan annotation results/product/InterPro Inc Average 90 stars, based on 1 article reviews
interproscan annotation results - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
InterPro Inc
interproscan prediction InterproScan menu item that appears when the Data Integration link is selected to explore relevant protein signatures of the InterPro member databases. " width="250" height="auto" />Interproscan Prediction, supplied by InterPro Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/interproscan prediction/product/InterPro Inc Average 90 stars, based on 1 article reviews
interproscan prediction - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Genoscope
interproscan InterproScan menu item that appears when the Data Integration link is selected to explore relevant protein signatures of the InterPro member databases. " width="250" height="auto" />Interproscan, supplied by Genoscope, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/interproscan/product/Genoscope Average 90 stars, based on 1 article reviews
interproscan - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
InterPro Inc
interpro protein InterproScan menu item that appears when the Data Integration link is selected to explore relevant protein signatures of the InterPro member databases. " width="250" height="auto" />Interpro Protein, supplied by InterPro Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/interpro protein/product/InterPro Inc Average 90 stars, based on 1 article reviews
interpro protein - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
InterPro Inc
interproscan search InterproScan menu item that appears when the Data Integration link is selected to explore relevant protein signatures of the InterPro member databases. " width="250" height="auto" />Interproscan Search, supplied by InterPro Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/interproscan search/product/InterPro Inc Average 90 stars, based on 1 article reviews
interproscan search - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: BMC Genomics
Article Title: The transcriptome of the NZ endemic sea urchin Kina ( Evechinus chloroticus )
doi: 10.1186/1471-2164-15-45
Figure Lengend Snippet: GO annotations. Top 10 represented GO terms for each of the GO categories; Molecular Function, Biological Process and Cellular Component. GO terms annotated by protein similarity to the NCBI non-redundant database and from InterProScan results.
Article Snippet: Additional GO terms could be retrieved from the
Techniques:
Journal: BMC Genomics
Article Title: The transcriptome of the NZ endemic sea urchin Kina ( Evechinus chloroticus )
doi: 10.1186/1471-2164-15-45
Figure Lengend Snippet: InterPro annotations. Top 10 represented InterPro terms from the InterProScan annotations.
Article Snippet: Additional GO terms could be retrieved from the
Techniques:
Journal: BMC Genomics
Article Title: ConiferEST: an integrated bioinformatics system for data reprocessing and mining of conifer expressed sequence tags (ESTs)
doi: 10.1186/1471-2164-8-134
Figure Lengend Snippet: Using web interfaces to identify chimeric EST sequences and clusters . Panel A . When the user clicks the Reverse Complement menu item displayed when the Detailed Data link in the Putative Sequence Control Panel is selected, a reverse complement view will be shown. COLD1_10_H04.b1_A029 is a 3'-end sequence with a verified 5' terminus in NS (or 3' terminus in SS in reverse complementary view) and "double-termini adapters". Its 5' counterpart, COLD1_10_H04.g1_A029, also has "double-termini adapters" and a detectable polyA tail. Panel B . Like Putative Sequence Control Panel , Verified Sequence Control Panel provides users many options for customizing their sequence views but focuses on verified features. For a given sequence, checking the Final Sequence box within the Verified Sequence Control Panel and then clicking Redraw Graph button, highlights with a red background the final sequence, which can then be directed to other search tools or cut-and-pasted into other applications. RTNACL1_14_G12.g1_A029 is a 5'-end sequence without any verified terminus. The last 28 bases ( i . e ., AAATAAATGGCGACTGTATGTGGACGAC, the bases with black background) of its final sequence have been manually highlighted with the cursor for illustration purpose. Panel C . Clicking the Gene Index menu item displayed when the Data Integration link in Putative/Verified Sequence Control Panel is selected, pops-up the relevant Gene Index cluster view. As shown, all three above-mentioned sequences are found in cluster TC65773, where COLD1_10_H04.g1_A029 is labelled as " 5a ", COLD1_10_H04.b1_A029 as " 5b ", and RTNACL_14_G12.g1_A029 as " 8 " within the cluster alignment graph. To verify the alignment, we found the last 28 bases of RTNACL1_14_G12.g1_A029 were located from 867 to 894 in COLD1_10_H04.b1_A029 (reverse complement) and from 635 to 662 in COLD1_10_H04.g1_A029. It appears that the whole cluster obtains about 300 extra bases in its 3' end because of the double-termini adapters. Panel D . By clicking the ORF menu item available after the Data Integration link in Putative/Verified Sequence Control Panel is selected, the final sequence for a given sequence read will be dynamically sent out for open reading frame detection. As shown, RTNACL1_14_G12.g1_A029 displays 6-frame ORF results. If available, the user can follow the InterproScan menu item that appears when the Data Integration link is selected to explore relevant protein signatures of the InterPro member databases.
Article Snippet: For 43,857 peptides identified in the current ConiferEST release, 27,104 retreived
Techniques: Sequencing, Control
Journal: BMC Genomics
Article Title: ConiferEST: an integrated bioinformatics system for data reprocessing and mining of conifer expressed sequence tags (ESTs)
doi: 10.1186/1471-2164-8-134
Figure Lengend Snippet: Snapshots of ConiferEST Web Portals . Panel A : All cDNA libraries of Pinus taeda have been differentially categorized for easy data navigation and comparison. For fast retrieval of individual sequences, users first select the ConiferEST option within the pull-down menu shown in the top portion. Users then enter either the specific sequence name ( e.g ., FLD1_34_H08.g1_A029), GenBank accession ( e.g ., CO162374), or GenBank gi number ( e.g ., 48932915), and click the Go button. Panel B : After choosing one or more libraries from the expandable tree shown in Panel A, the database query interface provides users three options, one of which is "Sequences with putative features". As shown, there is a variety of data filters that can be applied to retrieve putative feature data in terms of users' needs. Panel C : The second option is "Sequences with verified features". Users can not only specify sequences with or without certain verified termini, but also require specific length for verified polyA and/or polyT tails. Panel D : The third option is "Sequence with InterproScan annotation". Users can choose among different InterPro Member databases. They can also conduct advanced field search by text pattern matching. Panel E : Clicking the Submit button shown in the Panel D returns the sortable, tabulated InterProScan results from the database.
Article Snippet: For 43,857 peptides identified in the current ConiferEST release, 27,104 retreived
Techniques: Comparison, Sequencing